Everything below concerns gastric juice protein. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Last reviewed on 2025-12-29. Where a claim depends on a specific study, the study is described rather than over-claimed.
Published work on BPC-157 spans several decades and covers a wide range of experimental models. Much of the early literature reports outcomes in animal studies involving induced injury to the gastrointestinal tract, tendons, and other tissues. The volume of preclinical reports is large, while controlled human trials remain scarce. This imbalance is a recurring point of discussion, because animal findings do not automatically translate into human effects. Reviews often note that study designs differ substantially across laboratories.
Interest in the peptide has grown through online communities that discuss self-administered use, which sits outside formal research settings. Regulatory status varies by country, and in many jurisdictions the compound is not approved as a therapeutic product. Questions about optimal routes of administration, long-term effects, and dose-response relationships remain open. Published pharmacokinetic data in humans are limited, and much of what circulates in popular discussion is extrapolated from animal work rather than measured directly in people.
Outside laboratory supply channels, the peptide is sold as a research chemical, a category that carries no requirement to demonstrate purity, identity, or freedom from contamination. Because it is not an approved medicine, products labeled BPC-157 sit in a regulatory gap in many countries, and actual content may differ from the label. Sports organizations list it among prohibited substances, so its presence in an athlete's sample can produce a doping finding regardless of how the material was obtained.
BPC-157 is a synthetic peptide of fifteen amino acids, written as GEPPPGKPADDAGLV, whose sequence matches part of a larger protein identified in human gastric juice. That parent protein was described in stomach-secretion research, and the fifteen-residue fragment was named body protection compound, which gives the peptide its common label. Material used in experiments is produced by solid-phase peptide synthesis rather than extracted from tissue. The reported molecular weight is about 1419 daltons, and the chain contains several proline residues, a feature that appears in discussions of its resistance to enzymatic breakdown.
| Property | Value | Notes |
|---|---|---|
| Chemical class | Synthetic pentadecapeptide | Fifteen amino acids; sequence matches a fragment of a gastric juice protein |
| Molecular formula | C62H98N16O22 | Corresponds to a molecular mass near 1419 Da |
| Primary origin | Fragment of human gastric juice protein BPC | First characterized in the early 1990s |
| Common synonyms | BPC 157; PL 14736; pentadecapeptide BPC 157 | Naming conventions vary across publications |
| Reported stability | Stable in gastric juice during in vitro incubation | Based on laboratory incubation, not clinical data |
The sequence places several glycine and proline residues near the middle, which may influence how the chain folds in solution. The peptide is linear rather than cyclic, and it carries no disulfide bridges. Commercial material is commonly supplied as the acetate salt, although the free base and other counterion forms also appear. Because the term BPC-157 refers to a specific sequence, samples with slight sequence variants are chemically different substances. Published work generally treats the fifteen-residue sequence as the defining structure.
Physical descriptions in supplier documents and papers usually list the compound as a white to off-white powder. It dissolves readily in water and in common aqueous buffers, and solutions are often prepared fresh before an experiment. Molecular mass near 1419 daltons helps verify identity during mass spectrometry. The powder is somewhat hygroscopic, so moisture exposure can alter the measured mass of a sample. Purity is typically reported as a percentage from chromatographic analysis.
BPC-157 is a synthetic peptide built from fifteen amino acid residues. Its sequence comes from a larger protein fragment that researchers isolated from human gastric juice and described as a body protection compound. The fragment contains glycine, glutamic acid, five prolines, lysine, alanine, two aspartic acids, leucine, and valine. The number 157 in the name refers to the position of the stretch within the parent protein. Material used in laboratories is manufactured rather than extracted from stomach fluid.
The molecule carries 15 residues, a molar mass near 1419.5 g/mol, and the formula C62H98N16O22. Its structure features a proline-rich central region, a pair of adjacent aspartic acid residues, and no cysteine. The absence of cysteine means no disulfide bonds can form, which simplifies refolding and reconstitution. Suppliers usually ship the material as a freeze-dried powder that appears white to off-white. It dissolves readily in water and in saline solutions.
Most early work on this peptide originated in the 1990s from a research group in Zagreb, Croatia, relying on animal models and cell cultures. Reported observations included effects on gastrointestinal lesion healing, tendon fibroblast migration, and blood vessel formation under controlled laboratory conditions. These findings come predominantly from rodent studies and in vitro assays rather than from human trials. Controlled human data remain limited, and the degree to which animal results translate to human physiology is an open question rather than a settled fact.
Within the research literature, the peptide is discussed through several provisional mechanisms, including cytoprotection, modulation of growth factor signaling, and interaction with the nitric oxide system. None of these mechanisms is fully characterized, and no single pathway is universally accepted. Review articles typically note the gap between consistent animal findings and sparse human evidence. The compound is classified as a research chemical rather than an approved pharmaceutical, which shapes how studies are designed, funded, and reported.
BPC-157 is a synthetic pentadecapeptide with the sequence GEPPPGKPADDAGLV, corresponding to a partial fragment of a larger protein detected in human gastric juice. The name derives from the parent protein designation BPC, an abbreviation of body protection compound, with 157 acting as a fraction or batch identifier used by the original investigators. Its molecular weight is approximately 1419 daltons, and the chain contains no unusual residues or disulfide bridges. In the literature it is described as a short, water-soluble fragment rather than a complete natural protein.
Algae has shown selectivity for strontium in studies, where most plants used in bioremediation have not shown selectivity between calcium and strontium, often becoming saturated with calcium, which is present in greater quantities in nuclear waste. Strontium-90 with a half-life around 30 years, is classified as high-level waste. Researchers have looked at the bioaccumulation of strontium by Scenedesmus spinosus (algae) in simulated wastewater. The study claims a highly selective biosorption capacity for strontium of S. spinosus, suggesting that it may be appropriate for use of nuclear wastewater. A study of the pond alga Closterium moniliferum using non-radioactive strontium found that varying the ratio of barium to strontium in water improved strontium selectivity.
=== Use in drug-induced neutropenia === Neutropenia can be a severe side effect of clozapine, an antipsychotic medication in the treatment of schizophrenia. G-CSF can restore neutrophil count. Following a return to baseline after stopping the drug, it may sometimes be safely rechallenged with the added use of G-CSF.
=== Eruption of the fighting === 27 December 1918: The uprising starts in the evening with shooting in front of Poznań's police headquarters. Fighting also start in other towns: Szamotuły, Środa Wielkopolska, Pniewy, Opalenica, Buk, Trzemeszno, Września and Gniezno are captured. Poles in Poznań capture the main train station, the main post office and part of city fortifications. 28 December 1918: The Poles in Poznań capture Cytadela (a main stronghold), Fort Grolmann and an armory on ul. Wielkie Garbary The commission of the NRL promotes Captain Stanisław Taczak to temporary commander-in-chief of the uprising (he is also promoted to rank of major). 29 December 1918: The Poles capture Grodzisk Wielkopolski, Kłecko, Kórnik, Wielichowo, Gostyń, Witkowo and other towns. 30 December 1918 Failure of peace talks between the insurgents and the German authorities, the latter refusing to take the responsibility for the hostilities of 27 December. In Poznań, the Poles force the German 6th Regiment of Grenadiers from their barracks. After talks, the regiment leaves the city with their weapons. The Poles capture Wronki, Wągrowiec, Gołańcz. Polish soldiers stop a German offensive against Gniezno near Zdziechowa. 31 December 1918 The Poles capture Kościan, Oborniki Wielkopolskie, Ostrów Wielkopolski. A unit of Poles under command of Paweł Cyms begins offensive on Cuiavia. 1 January 1919 Paderewski leaves Poznań. The capture of Jarocin, Krotoszyn and Mogilno.
==== Hepatitis ==== In this pattern, hepatocellular necrosis is associated with infiltration of inflammatory cells. There can be three types of drug-induced hepatitis. (A) viral hepatitis is the most common, where histological features are similar to acute viral hepatitis. (B) in focal or non-specific hepatitis, scattered foci of cell necrosis may accompany lymphocytic infiltration. (C) chronic hepatitis is very similar to autoimmune hepatitis clinically, serologically, and histologically.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
Sources: en.wikipedia.org
=== Act 2 === Lucinda, a runaway slave, rifles through the pockets of the dead chain gang prisoners. Inman regains consciousness and awakens, which startles her. Lucinda frees Inman, who resumes his journey. Back at Black Cove Farm, Stobrod and his traveling companion Pangle still rely upon Ruby and Ada for sustenance. Stobrod tries to convince Ruby that he is a changed man, but Ruby remains skeptical. Inman meets Sara, a war widow, who is trying to comfort her baby. Inman helps her, gains her trust, and is invited to spend the night. At Black Cove Farm, Teague appears, with a copy of the newspaper that lists the names of deserters, on which Ruby sees her father's name. The next morning, Inman and Sara react quickly when Union soldiers appear. At a campfire in the woods, Teague and his men confront Stobrod and Pangle, shoot them and leave them for dead. Ada finds the two men, and expresses compassion for Stobrod ("I feel sorry for you"). Ada later goes hunting in the woods. There, she and Inman reunite. The other characters whom Inman has encountered on his odyssey appear to Inman, and urge him to tell Ada about his adventures ("Tell her of the slave you met"; "Tell her how the boat went down"). The couple affirms their pledge to each other. Teague continues his pursuit. Ada and Inman consummate their love, on their final night together. Eventually, Teague and the Home Guard track down Inman. In the final battle, Inman is killed.
== Sustainable cities == Sustainable Cities Index 2018: Bangkok ranked 80 of 100 cities (1=best; 100=worst). Other ASEAN cities ranked were: Singapore, 4; Kuala Lumpur, 67; Jakarta, 94; Manila, 95; Hanoi. 98. Sustainable Cities Index 2016: In this study by Arcadis NV, a Dutch design, engineering, and management consulting company, Bangkok ranked 67 of 100 (1=best; 100 worst) global cities. Other ASEAN cities ranked were Singapore, 2; Kuala Lumpur, 55; Hanoi, 87; Jakarta, 88; and Manila, 96.
If a strut of nasal-septum cartilage proves too weak, then a rib cartilage strut can be applied to provide the adequate nasal support; afterwards, the strut is covered with onlay grafts. Absent alar cartilages can be replaced using all of the conchal cartilage from both ears; two strips, each 10 mm wide, are harvested from the antihelical fold, and then are applied as replacement alar wings. The surgeon attaches them to the anterior nasal spine, and to each side of the (pear-shaped) pyriform aperture; the remainder of the harvested conchal cartilage is applied as onlay grafts to augment the nasal tip. A nasal-tip lining defect is unusual, because of its midline location; yet, the reconstruction is with an anteriorly based septal mucosal flap that is rotated into place to provide adequate coverage and correction of the nasal lining defect. Vertical lobule division (VLD) is a common technique for nasal tip refinement, which involves the medial crural angle and the lateral crural angle. (d) Alar lobule defect The appropriate surgical management of an alar lobule defect depends upon the dimensions (length, width, depth) of the wound. Anatomically, the nasal skin and the underlying soft tissues of the alar lobule form a semi-rigid aesthetic subunit that forms the graceful curve of the alar rim, and provides unobstructed airflow through the nostrils, the anterior nares.
=== Commercial applications === Similar to other networking technologies that began with the defense sector, e.g., the Defense Advanced Research Projects Agency (DARPA) funding ARPANET, the precursor to the Internet, DASH7 is similarly suited to a wide range of applications in development or being deployed, including:
Sources: en.wikipedia.org
A vaccine to remove senescent cells, a key driver of the aging process, is demonstrated in mice by researchers from Japan. The American biotechnology company Altos Labs, which focuses on life extension research, is founded.
== Additional future research == Positive psychology research and practice is currently conducted and developed in various countries throughout the world. To illustrate, in Canada, Charles Hackney of Briercrest College applies positive psychology to the topic of personal growth through martial arts training; Paul Wong, president of the International Network on Personal Meaning, is developing an existential approach to positive psychology, which is framed in the second wave positive psychology (PP 2.0). The research program 'Understanding Positive Emotions' at Human Science Lab, London, investigates how material well-being and perceptual well-being work as relative determinants in conditioning our mind for positive emotions. Cognitive and behavioral change, although sometimes slight and complex, can produce an 'intense affect'. Isen (2009) remarked that further progress requires suitable research methods, and appropriate theories on which to base contemporary research. Chang (2008) suggested that researchers have a number of paths to pursue regarding the enhancement of emotional intelligence, even though emotional intelligence does not guarantee the development of positive affect; in short, more study is required to track the gradient of positive affect in psychology.
== Inside the body == Hemolysis inside the body can be caused by a large number of medical conditions, including some parasites (e.g., Plasmodium), some autoimmune disorders (e.g., autoimmune haemolytic anaemia), drug-induced hemolytic anemia, atypical hemolytic uremic syndrome (aHUS)), some genetic disorders (e.g., Sickle-cell disease or G6PD deficiency), or blood with too low a solute concentration (hypotonic to cells). Hemolysis can lead to hemoglobinemia due to hemoglobin released into the blood plasma, which plays a significant role in the pathogenesis of sepsis and can lead to increased risk of infection due to its inhibitory effects on the innate immune system.
Sources: en.wikipedia.org
It is a synthetic peptide of fifteen amino acids whose sequence matches a fragment of a protein found in human gastric juice. It is studied mainly in laboratory and animal research rather than as an approved medicine.
The letters abbreviate body protection compound, the name given to the parent protein isolated from gastric juice. The number is an identifier attached to the specific fragment, not a dose or a description of a chemical property.
The sequence corresponds to a segment of an endogenous gastric protein, but the isolated fifteen-amino-acid peptide is a synthetic construct. Whether the free fragment circulates in humans at measurable levels is not clearly established in the published literature.
It is not approved for human use in the United States or the European Union. Clinical material has been studied in a small number of early trials, mainly for inflammatory bowel conditions, and the compound remains investigational. Regulators treat marketed products as unapproved rather than as authorized drugs.